500 IF PRTFLG=1 THEN OPEN +quot;LPT1:+quot; FOR OUTPUT AS #2 505 IF PRTFLG=2 THEN INPUT +q

---
Master Index Current Directory Index Go to SkepticTank Go to Human Rights activist Keith Henson Go to Scientology cult

Skeptic Tank!

500 IF PRTFLG=1 THEN OPEN "LPT1:" FOR OUTPUT AS #2 505 IF PRTFLG=2 THEN INPUT "Enter the file which is to recieve the output: ",A$:OPEN DISK$+A$ FOR OUTPUT AS #2:PRINT 510 RESTORE:DIM SEQ(5000),USED(64) 515 INPUT "ENTER THE NUMBER OF EXONS: ",EX 520 FOR I=1 TO EX 525 PRINT 530 PRINT "ENTER THE NUMBERS OF THE FIRST AND LAST BASES IN EXON ";I 535 INPUT;FIRST(I), LAST(I) 540 NEXT I 545 L=0:PRINT:PRINT:PRINT "Reassigning your sequence. Please wait." 550 FOR J=1 TO EX 555 FOR I=FIRST(J) TO LAST(J) 560 L=L+1 565 SEQ(L)=ASC(MID$(SEQ$((I-1)\250+1),(I-1) MOD 250+1,1)) 570 NEXT 575 NEXT 580 DATA Ala,4,52,53,54,55,71,Arg,6,28,29,30,31,46,47,156,Asn,2,40,41,114,Asp,2,56,57,115 585 DATA Cys,2,12,13,103,Gln,2,26,27,128,Glu,2,58,59,129,Gly,4,60,61,62,63,57,His,2,24,25,137,Ile,3,32,33,34,113 590 DATA Leu,6,2,3,16,17,18,19,113,Lys,2,42,43,128,Met,1,35,131,Phe,2,0,1,147,Pro,4,20,21,22,23,97 595 DATA Ser,6,4,5,6,7,44,45,87,Thr,4,36,37,38,39,101,Trp,1,15,186,Tyr,2,8,9,163,Val,4,48,49,50,51,99 600 DATA END,3,10,11,14,0 605 CODE$="TTTTTCTTATTGTCTTCCTCATCGTATTACTAATAGTGTTGCTGATGGCTTCTCCTACTGCCTCCCCCACCGCATCACCAACAGCGTCGCCGACGGATTATCATAATGACTACCACAACGAATAACAAAAAGAGTAGCAGAAGGGTTGTCGTAGTGGCTGCCGCAGCGGATGACGAAGAGGGTGGCGGAGGG" 610 TOTAL = 0:SUMAL=0:SUMAG=0:MW=0 615 FOR J=1 TO L STEP 3 620 CODON=0 625 FOR K=0 TO 2 630 IF SEQ(J+K)=84 THEN GOTO 655 635 IF SEQ(J+K)=67 THEN CODON=CODON+4^(2-K):GOTO 655 640 IF SEQ(J+K)=65 THEN CODON=CODON+2*4^(2-K):GOTO 655 645 IF SEQ(J+K)=71 THEN CODON=CODON+3*4^(2-K):GOTO 655 650 CODON=-65 655 NEXT K 660 IF CODON<0 THEN PRINT "INVALID CODON AT BASE";J:GOTO 670 665 TOTAL=TOTAL+1:USED(CODON)=USED(CODON)+1 670 NEXT J 675 TOTAL=TOTAL-1 680 CLS:IF PRTFLG THEN PRINT #2,TITLE$:PRINT #2,"" 685 FOR I=1 TO 21 690 SUM=0:SUMP=0 695 READ A$:READ N:PRINT A$;" ";:IF PRTFLG THEN PRINT #2,A$;" "; 700 FOR J=1 TO N 705 IF J=5 THEN PRINT:PRINT " ";:IF PRTFLG THEN PRINT #2,"":PRINT #2," "; 710 READ CODON:PRINT " (";MID$(CODE$,3*CODON+1,3);")";:IF PRTFLG THEN PRINT #2," (";MID$(CODE$,3*CODON+1,3);")"; 715 PRINT USING " ## ";USED(CODON);:IF PRTFLG THEN PRINT #2,USING " ## ";USED(CODON); 720 SUM=SUM+USED(CODON):SUMP=SUMP+100*USED(CODON)/TOTAL 725 IF I=2 OR I=12 THEN SUMAL=SUMAL+USED(CODON) 730 IF I=4 OR I=7 THEN SUMAG=SUMAG+USED(CODON) 735 NEXT J 740 READ RW:MW=MW+SUM*RW 745 PRINT TAB(55):PRINT A$;:PRINT USING " ### ##.##";SUM;SUMP;:IF PRTFLG THEN PRINT #2,TAB(55):PRINT #2,A$;:PRINT #2,USING " ### ##.##";SUM;SUMP; 750 IF I<21 GOTO 765 755 IF SCRFLG GOTO 765 ELSE BEEP 760 A$=INKEY$:IF A$="" GOTO 760 765 PRINT:IF PRTFLG THEN PRINT #2,"" 770 NEXT I 775 PRINT:PRINT:PRINT "Molecular Weight =";MW+18:IF PRTFLG THEN PRINT #2,"":PRINT #2,"":PRINT #2,"molecular weight =";MW+18 780 PRINT "Number of amino acids =";TOTAL:IF PRTFLG THEN PRINT #2,"number of amino acids =";TOTAL 785 PRINT "Arg + Lys =";SUMAL:IF PRTFLG THEN PRINT #2,"Arg + Lys =";SUMAL 790 PRINT "Asp + Glu =";SUMAG:IF PRTFLG THEN PRINT #2,"Asp + Glu =";SUMAG 795 ERASE SEQ,USED:CLOSE:RETURN 1000 END

---

E-Mail Fredric L. Rice / The Skeptic Tank