In past messages, I have noted that the origin of novel genetic information new genes, wit

---
Master Index Current Directory Index Go to SkepticTank Go to Human Rights activist Keith Henson Go to Scientology cult

Skeptic Tank!

Organization: University of Illinois at Urbana From: maier@romulus (Chuck Maier) Message-ID: BrAM8n.I6M@news.cso.uiuc.edu Newsgroups: talk.origins In past messages, I have noted that the origin of novel genetic information - new genes, with new functions - is really the only question of interest. Evolutionists claim that duplication and subsequent mutation of preexisting genes can account for new genetic information. Let me restate the problem, with today's appeal to authority from creationist molecular biologist, Dr. Raymond G. Bohlin, and then look at a supposed evolutionary solution as proferred by Chris Colby recently: Bohlin writes (Natural Limits to Biological Variation): "The ususal answer given to the dilemma of new genetic information is that as a gene continues to mutate, eventually something different will arise. But immmediately several questions come to our minds. What function, for example, is thisprotein performing while all this mutating is going on? Is its function slowly changing ? If so, is its former function still needed? If not, why not? And if so then how is the former function being handled? How is the new gene escaping its old control mechanism and establishing new one? But even beyond these questions, the oly observational evidenc we have so far contradicts the possibility that mutations can produce a truly new gene, a nonallel iin a category of structure and function . [Note, for instance, even myoglobin/ hemoglobin duplication, even if it had happened, would not qualify as both are oxygen carriers]. This is not to say that such evidence can never be found, but as each year goes by without such evidence, the likelihood diminishes." So, according to Bohlin, we have no REAL evidence as to how any really new genes arise. Here is a recent abstract from an article suggested by Chris Colby as an answer to the question . TI AN EVOLUTIONARY MODEL FOR THE DUPLICATION AND DIVERGENCE OF ESTERASE GENES IN DROSOPHILA. SO JOURNAL-OF-MOLECULAR-EVOLUTION. 1992, JUN, V34, N6, P506-521. AB The esterase 5 (Est-5 = gene, EST 5 = protein) enzyme in Drosophila pseudoobscura is encoded by one of three paralogous genes, Est-5A, Est-5B, and Est-5C, that are tightly clustered on the right arm of the X chromosome. The homologous Est-6 locus in Drosophila melanogaster has only one paralogous neighbor, Est-P. Comparisons of coding and flanking DNA sequences among the three D. pseudoobscura and two D. melanogaster genes suggest that two paralogous genes were present before the divergence of D. pseudoobscura from D. melanogaster and that, later, a second duplication occurred in D. pseudoobscura. Nucleotide sequences of the coding regions of the three D. pseudoobscura genes showed 78-85% similarity in pairwise comparisons, whereas the relatedness between Est-6 and Est-P was only 67%. The higher degree of conservation in D. pseudoobscura likely results from the comparatively recent divergence of Est-5B and Est-5C and from possible gene conversion events between Est-5A and Est-5B. Analyses of silent and replacement site differences in the two exons of the paralogous and orthologous genes in each species indicate that common selective forces are acting on all five loci. Further evidence for common purifying selective constraints comes from the conservation of hydropathy profiles and proposed catalytic residues. However, different levels of amino acid substitution between the paralogous genes in D. melanogaster relative to those in D. pseudoobscura suggest that interspecific differences in selection also exist. END OF REQUEST There is nothing here to indicate any development of any new function other than that always performed by an esterase ( which, I presume, is making ester bond formation a tad easier). As ususal, some sequence comparisons, lots of conjecture, fruit flies at the start, and fruit flies at the finish. Below we have a little more ambitious claim for the evolution of a new gene from an ancestral esterase gene: TI EVOLUTIONARY ORIGIN OF THYROGLOBULIN BY DUPLICATION OF ESTERASE GENE SO FEBS-LETTERS. 1991, APR 22, V282, N1, P17-22. AB Rat liver microsomal carboxyesterase E1 was found to have homology with five esterases and with the COOH-terminal parts of two thyroglobulins. A phylogenetic tree constructed for these proteins shows that this new superfamily has evolved from a common ancestral gene that encoded a carboxyesterase. The tree also shows that the ancestral gene already existed before the divergence of vertebrates and invertebrates and later its duplicated genes gained various kinds of esterase activity. According to the tree, one of the duplicated genes evolved into the COOH-terminal half of thyroglobulin by a gene fusion with a DNA sequence whose evolutionary origin is unknown. END OF REQUEST Of course, nobody was in the lab watching an esterase wondrously change into a thyroglobulin. This is nothing more than the usual comparison of primary sequences ..... ATGCTGATCACGATCATCATGACTGACTAAGTT ....(i.e ancestral esterase). : : : : : : : : GCTACGCAGTATGACTCATCATCATTATCTACG ...... (thyroglobulin) ....where a few points of homology in the sequences are picked out and one is claimed to have evolved from the other. Great evolutionary significance is ascribed to this, yet there is no evaluation of intermediate states and functions through the course of the supposed evolution of these molecules. (DNA sequences above are exemplary only).

---

E-Mail Fredric L. Rice / The Skeptic Tank